ID: 938077496

View in Genome Browser
Species Human (GRCh38)
Location 2:128347398-128347420
Sequence CACTTTTAGGACCATCAGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938077492_938077496 7 Left 938077492 2:128347368-128347390 CCTATGGTCAGCCCATGGGGGAA No data
Right 938077496 2:128347398-128347420 CACTTTTAGGACCATCAGCTAGG No data
938077486_938077496 12 Left 938077486 2:128347363-128347385 CCCTGCCTATGGTCAGCCCATGG No data
Right 938077496 2:128347398-128347420 CACTTTTAGGACCATCAGCTAGG No data
938077493_938077496 -4 Left 938077493 2:128347379-128347401 CCCATGGGGGAAAATCATGCACT No data
Right 938077496 2:128347398-128347420 CACTTTTAGGACCATCAGCTAGG No data
938077485_938077496 19 Left 938077485 2:128347356-128347378 CCACAAGCCCTGCCTATGGTCAG No data
Right 938077496 2:128347398-128347420 CACTTTTAGGACCATCAGCTAGG No data
938077488_938077496 11 Left 938077488 2:128347364-128347386 CCTGCCTATGGTCAGCCCATGGG No data
Right 938077496 2:128347398-128347420 CACTTTTAGGACCATCAGCTAGG No data
938077494_938077496 -5 Left 938077494 2:128347380-128347402 CCATGGGGGAAAATCATGCACTT No data
Right 938077496 2:128347398-128347420 CACTTTTAGGACCATCAGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938077496 Original CRISPR CACTTTTAGGACCATCAGCT AGG Intergenic
No off target data available for this crispr