ID: 938077579

View in Genome Browser
Species Human (GRCh38)
Location 2:128347942-128347964
Sequence GAAGAGCACGTCCAGCTTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938077579_938077585 27 Left 938077579 2:128347942-128347964 CCAGGAAGCTGGACGTGCTCTTC No data
Right 938077585 2:128347992-128348014 TTGCTTGGCTTGGCTGCCACAGG No data
938077579_938077582 12 Left 938077579 2:128347942-128347964 CCAGGAAGCTGGACGTGCTCTTC No data
Right 938077582 2:128347977-128347999 TTTCTCTGCTCCTCGTTGCTTGG No data
938077579_938077583 17 Left 938077579 2:128347942-128347964 CCAGGAAGCTGGACGTGCTCTTC No data
Right 938077583 2:128347982-128348004 CTGCTCCTCGTTGCTTGGCTTGG No data
938077579_938077586 28 Left 938077579 2:128347942-128347964 CCAGGAAGCTGGACGTGCTCTTC No data
Right 938077586 2:128347993-128348015 TGCTTGGCTTGGCTGCCACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938077579 Original CRISPR GAAGAGCACGTCCAGCTTCC TGG (reversed) Intergenic
No off target data available for this crispr