ID: 938077581

View in Genome Browser
Species Human (GRCh38)
Location 2:128347965-128347987
Sequence GAGCAGAGAAAGAAGACTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938077581_938077586 5 Left 938077581 2:128347965-128347987 CCTGCAGTCTTCTTTCTCTGCTC No data
Right 938077586 2:128347993-128348015 TGCTTGGCTTGGCTGCCACAGGG No data
938077581_938077589 28 Left 938077581 2:128347965-128347987 CCTGCAGTCTTCTTTCTCTGCTC No data
Right 938077589 2:128348016-128348038 AGAGAGGATTTGCAGTGCAGAGG No data
938077581_938077587 12 Left 938077581 2:128347965-128347987 CCTGCAGTCTTCTTTCTCTGCTC No data
Right 938077587 2:128348000-128348022 CTTGGCTGCCACAGGGAGAGAGG No data
938077581_938077585 4 Left 938077581 2:128347965-128347987 CCTGCAGTCTTCTTTCTCTGCTC No data
Right 938077585 2:128347992-128348014 TTGCTTGGCTTGGCTGCCACAGG No data
938077581_938077583 -6 Left 938077581 2:128347965-128347987 CCTGCAGTCTTCTTTCTCTGCTC No data
Right 938077583 2:128347982-128348004 CTGCTCCTCGTTGCTTGGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938077581 Original CRISPR GAGCAGAGAAAGAAGACTGC AGG (reversed) Intergenic
No off target data available for this crispr