ID: 938077582

View in Genome Browser
Species Human (GRCh38)
Location 2:128347977-128347999
Sequence TTTCTCTGCTCCTCGTTGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938077577_938077582 25 Left 938077577 2:128347929-128347951 CCACAGATGTTTGCCAGGAAGCT No data
Right 938077582 2:128347977-128347999 TTTCTCTGCTCCTCGTTGCTTGG No data
938077579_938077582 12 Left 938077579 2:128347942-128347964 CCAGGAAGCTGGACGTGCTCTTC No data
Right 938077582 2:128347977-128347999 TTTCTCTGCTCCTCGTTGCTTGG No data
938077580_938077582 -10 Left 938077580 2:128347964-128347986 CCCTGCAGTCTTCTTTCTCTGCT No data
Right 938077582 2:128347977-128347999 TTTCTCTGCTCCTCGTTGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938077582 Original CRISPR TTTCTCTGCTCCTCGTTGCT TGG Intergenic
No off target data available for this crispr