ID: 938077584

View in Genome Browser
Species Human (GRCh38)
Location 2:128347987-128348009
Sequence GGCAGCCAAGCCAAGCAACG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938077584_938077590 14 Left 938077584 2:128347987-128348009 CCTCGTTGCTTGGCTTGGCTGCC No data
Right 938077590 2:128348024-128348046 TTTGCAGTGCAGAGGTAAAGAGG No data
938077584_938077587 -10 Left 938077584 2:128347987-128348009 CCTCGTTGCTTGGCTTGGCTGCC No data
Right 938077587 2:128348000-128348022 CTTGGCTGCCACAGGGAGAGAGG No data
938077584_938077589 6 Left 938077584 2:128347987-128348009 CCTCGTTGCTTGGCTTGGCTGCC No data
Right 938077589 2:128348016-128348038 AGAGAGGATTTGCAGTGCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938077584 Original CRISPR GGCAGCCAAGCCAAGCAACG AGG (reversed) Intergenic
No off target data available for this crispr