ID: 938077585

View in Genome Browser
Species Human (GRCh38)
Location 2:128347992-128348014
Sequence TTGCTTGGCTTGGCTGCCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938077579_938077585 27 Left 938077579 2:128347942-128347964 CCAGGAAGCTGGACGTGCTCTTC No data
Right 938077585 2:128347992-128348014 TTGCTTGGCTTGGCTGCCACAGG No data
938077581_938077585 4 Left 938077581 2:128347965-128347987 CCTGCAGTCTTCTTTCTCTGCTC No data
Right 938077585 2:128347992-128348014 TTGCTTGGCTTGGCTGCCACAGG No data
938077580_938077585 5 Left 938077580 2:128347964-128347986 CCCTGCAGTCTTCTTTCTCTGCT No data
Right 938077585 2:128347992-128348014 TTGCTTGGCTTGGCTGCCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938077585 Original CRISPR TTGCTTGGCTTGGCTGCCAC AGG Intergenic
No off target data available for this crispr