ID: 938077586

View in Genome Browser
Species Human (GRCh38)
Location 2:128347993-128348015
Sequence TGCTTGGCTTGGCTGCCACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938077581_938077586 5 Left 938077581 2:128347965-128347987 CCTGCAGTCTTCTTTCTCTGCTC No data
Right 938077586 2:128347993-128348015 TGCTTGGCTTGGCTGCCACAGGG No data
938077580_938077586 6 Left 938077580 2:128347964-128347986 CCCTGCAGTCTTCTTTCTCTGCT No data
Right 938077586 2:128347993-128348015 TGCTTGGCTTGGCTGCCACAGGG No data
938077579_938077586 28 Left 938077579 2:128347942-128347964 CCAGGAAGCTGGACGTGCTCTTC No data
Right 938077586 2:128347993-128348015 TGCTTGGCTTGGCTGCCACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938077586 Original CRISPR TGCTTGGCTTGGCTGCCACA GGG Intergenic
No off target data available for this crispr