ID: 938077589

View in Genome Browser
Species Human (GRCh38)
Location 2:128348016-128348038
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938077580_938077589 29 Left 938077580 2:128347964-128347986 CCCTGCAGTCTTCTTTCTCTGCT No data
Right 938077589 2:128348016-128348038 AGAGAGGATTTGCAGTGCAGAGG No data
938077581_938077589 28 Left 938077581 2:128347965-128347987 CCTGCAGTCTTCTTTCTCTGCTC No data
Right 938077589 2:128348016-128348038 AGAGAGGATTTGCAGTGCAGAGG No data
938077584_938077589 6 Left 938077584 2:128347987-128348009 CCTCGTTGCTTGGCTTGGCTGCC No data
Right 938077589 2:128348016-128348038 AGAGAGGATTTGCAGTGCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr