ID: 938078314

View in Genome Browser
Species Human (GRCh38)
Location 2:128353997-128354019
Sequence GCACACAATCCAGGCACTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938078314_938078319 -2 Left 938078314 2:128353997-128354019 CCATGAGTGCCTGGATTGTGTGC No data
Right 938078319 2:128354018-128354040 GCTCCCCCACTGTGGATGAGGGG No data
938078314_938078318 -3 Left 938078314 2:128353997-128354019 CCATGAGTGCCTGGATTGTGTGC No data
Right 938078318 2:128354017-128354039 TGCTCCCCCACTGTGGATGAGGG No data
938078314_938078316 -10 Left 938078314 2:128353997-128354019 CCATGAGTGCCTGGATTGTGTGC No data
Right 938078316 2:128354010-128354032 GATTGTGTGCTCCCCCACTGTGG No data
938078314_938078326 27 Left 938078314 2:128353997-128354019 CCATGAGTGCCTGGATTGTGTGC No data
Right 938078326 2:128354047-128354069 AAGCTGGCCACCACGCGATGTGG No data
938078314_938078324 11 Left 938078314 2:128353997-128354019 CCATGAGTGCCTGGATTGTGTGC No data
Right 938078324 2:128354031-128354053 GGATGAGGGGATCCGAAAGCTGG No data
938078314_938078327 28 Left 938078314 2:128353997-128354019 CCATGAGTGCCTGGATTGTGTGC No data
Right 938078327 2:128354048-128354070 AGCTGGCCACCACGCGATGTGGG No data
938078314_938078317 -4 Left 938078314 2:128353997-128354019 CCATGAGTGCCTGGATTGTGTGC No data
Right 938078317 2:128354016-128354038 GTGCTCCCCCACTGTGGATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938078314 Original CRISPR GCACACAATCCAGGCACTCA TGG (reversed) Intergenic
No off target data available for this crispr