ID: 938079140

View in Genome Browser
Species Human (GRCh38)
Location 2:128360031-128360053
Sequence CCGTGGGACCCTGAGTGTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938079130_938079140 9 Left 938079130 2:128359999-128360021 CCACCTGTGTCCCTGCTCAGCAT No data
Right 938079140 2:128360031-128360053 CCGTGGGACCCTGAGTGTCCAGG No data
938079134_938079140 -1 Left 938079134 2:128360009-128360031 CCCTGCTCAGCATGCCTGGCGGC No data
Right 938079140 2:128360031-128360053 CCGTGGGACCCTGAGTGTCCAGG No data
938079129_938079140 26 Left 938079129 2:128359982-128360004 CCAGGCTTCTTGCTGCTCCACCT No data
Right 938079140 2:128360031-128360053 CCGTGGGACCCTGAGTGTCCAGG No data
938079128_938079140 29 Left 938079128 2:128359979-128360001 CCACCAGGCTTCTTGCTGCTCCA No data
Right 938079140 2:128360031-128360053 CCGTGGGACCCTGAGTGTCCAGG No data
938079131_938079140 6 Left 938079131 2:128360002-128360024 CCTGTGTCCCTGCTCAGCATGCC No data
Right 938079140 2:128360031-128360053 CCGTGGGACCCTGAGTGTCCAGG No data
938079135_938079140 -2 Left 938079135 2:128360010-128360032 CCTGCTCAGCATGCCTGGCGGCC No data
Right 938079140 2:128360031-128360053 CCGTGGGACCCTGAGTGTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938079140 Original CRISPR CCGTGGGACCCTGAGTGTCC AGG Intergenic
No off target data available for this crispr