ID: 938079991

View in Genome Browser
Species Human (GRCh38)
Location 2:128364791-128364813
Sequence GGGAGTGTGGGCACTGGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938079991_938080007 21 Left 938079991 2:128364791-128364813 CCCTGCCCAGTGCCCACACTCCC No data
Right 938080007 2:128364835-128364857 CACCTTACCCCTGCACCAGTGGG No data
938079991_938080006 20 Left 938079991 2:128364791-128364813 CCCTGCCCAGTGCCCACACTCCC No data
Right 938080006 2:128364834-128364856 ACACCTTACCCCTGCACCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938079991 Original CRISPR GGGAGTGTGGGCACTGGGCA GGG (reversed) Intergenic
No off target data available for this crispr