ID: 938079992

View in Genome Browser
Species Human (GRCh38)
Location 2:128364792-128364814
Sequence TGGGAGTGTGGGCACTGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938079992_938080007 20 Left 938079992 2:128364792-128364814 CCTGCCCAGTGCCCACACTCCCA No data
Right 938080007 2:128364835-128364857 CACCTTACCCCTGCACCAGTGGG No data
938079992_938080006 19 Left 938079992 2:128364792-128364814 CCTGCCCAGTGCCCACACTCCCA No data
Right 938080006 2:128364834-128364856 ACACCTTACCCCTGCACCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938079992 Original CRISPR TGGGAGTGTGGGCACTGGGC AGG (reversed) Intergenic
No off target data available for this crispr