ID: 938079996

View in Genome Browser
Species Human (GRCh38)
Location 2:128364797-128364819
Sequence GGCCCTGGGAGTGTGGGCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938079996_938080007 15 Left 938079996 2:128364797-128364819 CCAGTGCCCACACTCCCAGGGCC No data
Right 938080007 2:128364835-128364857 CACCTTACCCCTGCACCAGTGGG No data
938079996_938080006 14 Left 938079996 2:128364797-128364819 CCAGTGCCCACACTCCCAGGGCC No data
Right 938080006 2:128364834-128364856 ACACCTTACCCCTGCACCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938079996 Original CRISPR GGCCCTGGGAGTGTGGGCAC TGG (reversed) Intergenic
No off target data available for this crispr