ID: 938079997

View in Genome Browser
Species Human (GRCh38)
Location 2:128364803-128364825
Sequence GTCTGGGGCCCTGGGAGTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938079997_938080006 8 Left 938079997 2:128364803-128364825 CCCACACTCCCAGGGCCCCAGAC No data
Right 938080006 2:128364834-128364856 ACACCTTACCCCTGCACCAGTGG No data
938079997_938080007 9 Left 938079997 2:128364803-128364825 CCCACACTCCCAGGGCCCCAGAC No data
Right 938080007 2:128364835-128364857 CACCTTACCCCTGCACCAGTGGG No data
938079997_938080013 27 Left 938079997 2:128364803-128364825 CCCACACTCCCAGGGCCCCAGAC No data
Right 938080013 2:128364853-128364875 GTGGGCTCCCTTGCCTTTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938079997 Original CRISPR GTCTGGGGCCCTGGGAGTGT GGG (reversed) Intergenic