ID: 938079998

View in Genome Browser
Species Human (GRCh38)
Location 2:128364804-128364826
Sequence GGTCTGGGGCCCTGGGAGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938079998_938080007 8 Left 938079998 2:128364804-128364826 CCACACTCCCAGGGCCCCAGACC No data
Right 938080007 2:128364835-128364857 CACCTTACCCCTGCACCAGTGGG No data
938079998_938080013 26 Left 938079998 2:128364804-128364826 CCACACTCCCAGGGCCCCAGACC No data
Right 938080013 2:128364853-128364875 GTGGGCTCCCTTGCCTTTGCTGG No data
938079998_938080006 7 Left 938079998 2:128364804-128364826 CCACACTCCCAGGGCCCCAGACC No data
Right 938080006 2:128364834-128364856 ACACCTTACCCCTGCACCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938079998 Original CRISPR GGTCTGGGGCCCTGGGAGTG TGG (reversed) Intergenic