ID: 938080000

View in Genome Browser
Species Human (GRCh38)
Location 2:128364812-128364834
Sequence TCTTCAAGGGTCTGGGGCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938080000_938080006 -1 Left 938080000 2:128364812-128364834 CCAGGGCCCCAGACCCTTGAAGA No data
Right 938080006 2:128364834-128364856 ACACCTTACCCCTGCACCAGTGG No data
938080000_938080007 0 Left 938080000 2:128364812-128364834 CCAGGGCCCCAGACCCTTGAAGA No data
Right 938080007 2:128364835-128364857 CACCTTACCCCTGCACCAGTGGG No data
938080000_938080013 18 Left 938080000 2:128364812-128364834 CCAGGGCCCCAGACCCTTGAAGA No data
Right 938080013 2:128364853-128364875 GTGGGCTCCCTTGCCTTTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938080000 Original CRISPR TCTTCAAGGGTCTGGGGCCC TGG (reversed) Intergenic
No off target data available for this crispr