ID: 938080002

View in Genome Browser
Species Human (GRCh38)
Location 2:128364819-128364841
Sequence TAAGGTGTCTTCAAGGGTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938080002_938080013 11 Left 938080002 2:128364819-128364841 CCCAGACCCTTGAAGACACCTTA No data
Right 938080013 2:128364853-128364875 GTGGGCTCCCTTGCCTTTGCTGG No data
938080002_938080006 -8 Left 938080002 2:128364819-128364841 CCCAGACCCTTGAAGACACCTTA No data
Right 938080006 2:128364834-128364856 ACACCTTACCCCTGCACCAGTGG No data
938080002_938080007 -7 Left 938080002 2:128364819-128364841 CCCAGACCCTTGAAGACACCTTA No data
Right 938080007 2:128364835-128364857 CACCTTACCCCTGCACCAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938080002 Original CRISPR TAAGGTGTCTTCAAGGGTCT GGG (reversed) Intergenic