ID: 938080003

View in Genome Browser
Species Human (GRCh38)
Location 2:128364820-128364842
Sequence GTAAGGTGTCTTCAAGGGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938080003_938080013 10 Left 938080003 2:128364820-128364842 CCAGACCCTTGAAGACACCTTAC No data
Right 938080013 2:128364853-128364875 GTGGGCTCCCTTGCCTTTGCTGG No data
938080003_938080007 -8 Left 938080003 2:128364820-128364842 CCAGACCCTTGAAGACACCTTAC No data
Right 938080007 2:128364835-128364857 CACCTTACCCCTGCACCAGTGGG No data
938080003_938080006 -9 Left 938080003 2:128364820-128364842 CCAGACCCTTGAAGACACCTTAC No data
Right 938080006 2:128364834-128364856 ACACCTTACCCCTGCACCAGTGG No data
938080003_938080017 30 Left 938080003 2:128364820-128364842 CCAGACCCTTGAAGACACCTTAC No data
Right 938080017 2:128364873-128364895 TGGAGACACAGCAGCACCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938080003 Original CRISPR GTAAGGTGTCTTCAAGGGTC TGG (reversed) Intergenic