ID: 938080004

View in Genome Browser
Species Human (GRCh38)
Location 2:128364825-128364847
Sequence CAGGGGTAAGGTGTCTTCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938080004_938080017 25 Left 938080004 2:128364825-128364847 CCCTTGAAGACACCTTACCCCTG No data
Right 938080017 2:128364873-128364895 TGGAGACACAGCAGCACCTGTGG No data
938080004_938080018 26 Left 938080004 2:128364825-128364847 CCCTTGAAGACACCTTACCCCTG No data
Right 938080018 2:128364874-128364896 GGAGACACAGCAGCACCTGTGGG No data
938080004_938080013 5 Left 938080004 2:128364825-128364847 CCCTTGAAGACACCTTACCCCTG No data
Right 938080013 2:128364853-128364875 GTGGGCTCCCTTGCCTTTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938080004 Original CRISPR CAGGGGTAAGGTGTCTTCAA GGG (reversed) Intergenic
No off target data available for this crispr