ID: 938080006

View in Genome Browser
Species Human (GRCh38)
Location 2:128364834-128364856
Sequence ACACCTTACCCCTGCACCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938080003_938080006 -9 Left 938080003 2:128364820-128364842 CCAGACCCTTGAAGACACCTTAC No data
Right 938080006 2:128364834-128364856 ACACCTTACCCCTGCACCAGTGG No data
938079995_938080006 15 Left 938079995 2:128364796-128364818 CCCAGTGCCCACACTCCCAGGGC No data
Right 938080006 2:128364834-128364856 ACACCTTACCCCTGCACCAGTGG No data
938080002_938080006 -8 Left 938080002 2:128364819-128364841 CCCAGACCCTTGAAGACACCTTA No data
Right 938080006 2:128364834-128364856 ACACCTTACCCCTGCACCAGTGG No data
938079996_938080006 14 Left 938079996 2:128364797-128364819 CCAGTGCCCACACTCCCAGGGCC No data
Right 938080006 2:128364834-128364856 ACACCTTACCCCTGCACCAGTGG No data
938080000_938080006 -1 Left 938080000 2:128364812-128364834 CCAGGGCCCCAGACCCTTGAAGA No data
Right 938080006 2:128364834-128364856 ACACCTTACCCCTGCACCAGTGG No data
938079998_938080006 7 Left 938079998 2:128364804-128364826 CCACACTCCCAGGGCCCCAGACC No data
Right 938080006 2:128364834-128364856 ACACCTTACCCCTGCACCAGTGG No data
938080001_938080006 -7 Left 938080001 2:128364818-128364840 CCCCAGACCCTTGAAGACACCTT No data
Right 938080006 2:128364834-128364856 ACACCTTACCCCTGCACCAGTGG No data
938079992_938080006 19 Left 938079992 2:128364792-128364814 CCTGCCCAGTGCCCACACTCCCA No data
Right 938080006 2:128364834-128364856 ACACCTTACCCCTGCACCAGTGG No data
938079999_938080006 0 Left 938079999 2:128364811-128364833 CCCAGGGCCCCAGACCCTTGAAG No data
Right 938080006 2:128364834-128364856 ACACCTTACCCCTGCACCAGTGG No data
938079997_938080006 8 Left 938079997 2:128364803-128364825 CCCACACTCCCAGGGCCCCAGAC No data
Right 938080006 2:128364834-128364856 ACACCTTACCCCTGCACCAGTGG No data
938079991_938080006 20 Left 938079991 2:128364791-128364813 CCCTGCCCAGTGCCCACACTCCC No data
Right 938080006 2:128364834-128364856 ACACCTTACCCCTGCACCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938080006 Original CRISPR ACACCTTACCCCTGCACCAG TGG Intergenic
No off target data available for this crispr