ID: 938080008

View in Genome Browser
Species Human (GRCh38)
Location 2:128364837-128364859
Sequence AGCCCACTGGTGCAGGGGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938080008_938080017 13 Left 938080008 2:128364837-128364859 CCTTACCCCTGCACCAGTGGGCT No data
Right 938080017 2:128364873-128364895 TGGAGACACAGCAGCACCTGTGG No data
938080008_938080019 27 Left 938080008 2:128364837-128364859 CCTTACCCCTGCACCAGTGGGCT No data
Right 938080019 2:128364887-128364909 CACCTGTGGGCCACATCTGTAGG No data
938080008_938080013 -7 Left 938080008 2:128364837-128364859 CCTTACCCCTGCACCAGTGGGCT No data
Right 938080013 2:128364853-128364875 GTGGGCTCCCTTGCCTTTGCTGG No data
938080008_938080018 14 Left 938080008 2:128364837-128364859 CCTTACCCCTGCACCAGTGGGCT No data
Right 938080018 2:128364874-128364896 GGAGACACAGCAGCACCTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938080008 Original CRISPR AGCCCACTGGTGCAGGGGTA AGG (reversed) Intergenic
No off target data available for this crispr