ID: 938080013

View in Genome Browser
Species Human (GRCh38)
Location 2:128364853-128364875
Sequence GTGGGCTCCCTTGCCTTTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938079997_938080013 27 Left 938079997 2:128364803-128364825 CCCACACTCCCAGGGCCCCAGAC No data
Right 938080013 2:128364853-128364875 GTGGGCTCCCTTGCCTTTGCTGG No data
938080008_938080013 -7 Left 938080008 2:128364837-128364859 CCTTACCCCTGCACCAGTGGGCT No data
Right 938080013 2:128364853-128364875 GTGGGCTCCCTTGCCTTTGCTGG No data
938080004_938080013 5 Left 938080004 2:128364825-128364847 CCCTTGAAGACACCTTACCCCTG No data
Right 938080013 2:128364853-128364875 GTGGGCTCCCTTGCCTTTGCTGG No data
938079998_938080013 26 Left 938079998 2:128364804-128364826 CCACACTCCCAGGGCCCCAGACC No data
Right 938080013 2:128364853-128364875 GTGGGCTCCCTTGCCTTTGCTGG No data
938080005_938080013 4 Left 938080005 2:128364826-128364848 CCTTGAAGACACCTTACCCCTGC No data
Right 938080013 2:128364853-128364875 GTGGGCTCCCTTGCCTTTGCTGG No data
938080002_938080013 11 Left 938080002 2:128364819-128364841 CCCAGACCCTTGAAGACACCTTA No data
Right 938080013 2:128364853-128364875 GTGGGCTCCCTTGCCTTTGCTGG No data
938079999_938080013 19 Left 938079999 2:128364811-128364833 CCCAGGGCCCCAGACCCTTGAAG No data
Right 938080013 2:128364853-128364875 GTGGGCTCCCTTGCCTTTGCTGG No data
938080001_938080013 12 Left 938080001 2:128364818-128364840 CCCCAGACCCTTGAAGACACCTT No data
Right 938080013 2:128364853-128364875 GTGGGCTCCCTTGCCTTTGCTGG No data
938080000_938080013 18 Left 938080000 2:128364812-128364834 CCAGGGCCCCAGACCCTTGAAGA No data
Right 938080013 2:128364853-128364875 GTGGGCTCCCTTGCCTTTGCTGG No data
938080003_938080013 10 Left 938080003 2:128364820-128364842 CCAGACCCTTGAAGACACCTTAC No data
Right 938080013 2:128364853-128364875 GTGGGCTCCCTTGCCTTTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938080013 Original CRISPR GTGGGCTCCCTTGCCTTTGC TGG Intergenic
No off target data available for this crispr