ID: 938080601

View in Genome Browser
Species Human (GRCh38)
Location 2:128367986-128368008
Sequence AGCCCACGGGGGCACTGTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938080591_938080601 3 Left 938080591 2:128367960-128367982 CCTGGGAGATGGCCCTGGGTTTG No data
Right 938080601 2:128367986-128368008 AGCCCACGGGGGCACTGTGAGGG No data
938080584_938080601 23 Left 938080584 2:128367940-128367962 CCGAAAGACTGGCTGTGGGCCCT No data
Right 938080601 2:128367986-128368008 AGCCCACGGGGGCACTGTGAGGG No data
938080596_938080601 -10 Left 938080596 2:128367973-128367995 CCTGGGTTTGGGAAGCCCACGGG No data
Right 938080601 2:128367986-128368008 AGCCCACGGGGGCACTGTGAGGG No data
938080594_938080601 -9 Left 938080594 2:128367972-128367994 CCCTGGGTTTGGGAAGCCCACGG No data
Right 938080601 2:128367986-128368008 AGCCCACGGGGGCACTGTGAGGG No data
938080590_938080601 4 Left 938080590 2:128367959-128367981 CCCTGGGAGATGGCCCTGGGTTT No data
Right 938080601 2:128367986-128368008 AGCCCACGGGGGCACTGTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938080601 Original CRISPR AGCCCACGGGGGCACTGTGA GGG Intergenic
No off target data available for this crispr