ID: 938081722

View in Genome Browser
Species Human (GRCh38)
Location 2:128373767-128373789
Sequence AGAAGACAGGGAGAATGGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938081722_938081732 25 Left 938081722 2:128373767-128373789 CCTTTCCATTCTCCCTGTCTTCT No data
Right 938081732 2:128373815-128373837 GCTGTGGGGTGCACTGAACTGGG No data
938081722_938081728 10 Left 938081722 2:128373767-128373789 CCTTTCCATTCTCCCTGTCTTCT No data
Right 938081728 2:128373800-128373822 GCTGCAGCCAAGCAAGCTGTGGG No data
938081722_938081731 24 Left 938081722 2:128373767-128373789 CCTTTCCATTCTCCCTGTCTTCT No data
Right 938081731 2:128373814-128373836 AGCTGTGGGGTGCACTGAACTGG No data
938081722_938081727 9 Left 938081722 2:128373767-128373789 CCTTTCCATTCTCCCTGTCTTCT No data
Right 938081727 2:128373799-128373821 TGCTGCAGCCAAGCAAGCTGTGG No data
938081722_938081733 26 Left 938081722 2:128373767-128373789 CCTTTCCATTCTCCCTGTCTTCT No data
Right 938081733 2:128373816-128373838 CTGTGGGGTGCACTGAACTGGGG No data
938081722_938081729 11 Left 938081722 2:128373767-128373789 CCTTTCCATTCTCCCTGTCTTCT No data
Right 938081729 2:128373801-128373823 CTGCAGCCAAGCAAGCTGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938081722 Original CRISPR AGAAGACAGGGAGAATGGAA AGG (reversed) Intergenic
No off target data available for this crispr