ID: 938081723

View in Genome Browser
Species Human (GRCh38)
Location 2:128373772-128373794
Sequence GTGTGAGAAGACAGGGAGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938081723_938081728 5 Left 938081723 2:128373772-128373794 CCATTCTCCCTGTCTTCTCACAC No data
Right 938081728 2:128373800-128373822 GCTGCAGCCAAGCAAGCTGTGGG No data
938081723_938081729 6 Left 938081723 2:128373772-128373794 CCATTCTCCCTGTCTTCTCACAC No data
Right 938081729 2:128373801-128373823 CTGCAGCCAAGCAAGCTGTGGGG No data
938081723_938081733 21 Left 938081723 2:128373772-128373794 CCATTCTCCCTGTCTTCTCACAC No data
Right 938081733 2:128373816-128373838 CTGTGGGGTGCACTGAACTGGGG No data
938081723_938081727 4 Left 938081723 2:128373772-128373794 CCATTCTCCCTGTCTTCTCACAC No data
Right 938081727 2:128373799-128373821 TGCTGCAGCCAAGCAAGCTGTGG No data
938081723_938081731 19 Left 938081723 2:128373772-128373794 CCATTCTCCCTGTCTTCTCACAC No data
Right 938081731 2:128373814-128373836 AGCTGTGGGGTGCACTGAACTGG No data
938081723_938081732 20 Left 938081723 2:128373772-128373794 CCATTCTCCCTGTCTTCTCACAC No data
Right 938081732 2:128373815-128373837 GCTGTGGGGTGCACTGAACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938081723 Original CRISPR GTGTGAGAAGACAGGGAGAA TGG (reversed) Intergenic