ID: 938081724

View in Genome Browser
Species Human (GRCh38)
Location 2:128373779-128373801
Sequence GCAGAAGGTGTGAGAAGACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938081724_938081731 12 Left 938081724 2:128373779-128373801 CCCTGTCTTCTCACACCTTCTGC No data
Right 938081731 2:128373814-128373836 AGCTGTGGGGTGCACTGAACTGG No data
938081724_938081728 -2 Left 938081724 2:128373779-128373801 CCCTGTCTTCTCACACCTTCTGC No data
Right 938081728 2:128373800-128373822 GCTGCAGCCAAGCAAGCTGTGGG No data
938081724_938081732 13 Left 938081724 2:128373779-128373801 CCCTGTCTTCTCACACCTTCTGC No data
Right 938081732 2:128373815-128373837 GCTGTGGGGTGCACTGAACTGGG No data
938081724_938081729 -1 Left 938081724 2:128373779-128373801 CCCTGTCTTCTCACACCTTCTGC No data
Right 938081729 2:128373801-128373823 CTGCAGCCAAGCAAGCTGTGGGG No data
938081724_938081727 -3 Left 938081724 2:128373779-128373801 CCCTGTCTTCTCACACCTTCTGC No data
Right 938081727 2:128373799-128373821 TGCTGCAGCCAAGCAAGCTGTGG No data
938081724_938081733 14 Left 938081724 2:128373779-128373801 CCCTGTCTTCTCACACCTTCTGC No data
Right 938081733 2:128373816-128373838 CTGTGGGGTGCACTGAACTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938081724 Original CRISPR GCAGAAGGTGTGAGAAGACA GGG (reversed) Intergenic