ID: 938081726

View in Genome Browser
Species Human (GRCh38)
Location 2:128373794-128373816
Sequence GCTTGCTTGGCTGCAGCAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938081726_938081732 -2 Left 938081726 2:128373794-128373816 CCTTCTGCTGCAGCCAAGCAAGC No data
Right 938081732 2:128373815-128373837 GCTGTGGGGTGCACTGAACTGGG No data
938081726_938081731 -3 Left 938081726 2:128373794-128373816 CCTTCTGCTGCAGCCAAGCAAGC No data
Right 938081731 2:128373814-128373836 AGCTGTGGGGTGCACTGAACTGG No data
938081726_938081733 -1 Left 938081726 2:128373794-128373816 CCTTCTGCTGCAGCCAAGCAAGC No data
Right 938081733 2:128373816-128373838 CTGTGGGGTGCACTGAACTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938081726 Original CRISPR GCTTGCTTGGCTGCAGCAGA AGG (reversed) Intergenic