ID: 938081727

View in Genome Browser
Species Human (GRCh38)
Location 2:128373799-128373821
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938081721_938081727 26 Left 938081721 2:128373750-128373772 CCAGCTGCAGGTCTTGGCCTTTC No data
Right 938081727 2:128373799-128373821 TGCTGCAGCCAAGCAAGCTGTGG No data
938081725_938081727 -4 Left 938081725 2:128373780-128373802 CCTGTCTTCTCACACCTTCTGCT No data
Right 938081727 2:128373799-128373821 TGCTGCAGCCAAGCAAGCTGTGG No data
938081722_938081727 9 Left 938081722 2:128373767-128373789 CCTTTCCATTCTCCCTGTCTTCT No data
Right 938081727 2:128373799-128373821 TGCTGCAGCCAAGCAAGCTGTGG No data
938081720_938081727 27 Left 938081720 2:128373749-128373771 CCCAGCTGCAGGTCTTGGCCTTT No data
Right 938081727 2:128373799-128373821 TGCTGCAGCCAAGCAAGCTGTGG No data
938081724_938081727 -3 Left 938081724 2:128373779-128373801 CCCTGTCTTCTCACACCTTCTGC No data
Right 938081727 2:128373799-128373821 TGCTGCAGCCAAGCAAGCTGTGG No data
938081723_938081727 4 Left 938081723 2:128373772-128373794 CCATTCTCCCTGTCTTCTCACAC No data
Right 938081727 2:128373799-128373821 TGCTGCAGCCAAGCAAGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type