ID: 938081731

View in Genome Browser
Species Human (GRCh38)
Location 2:128373814-128373836
Sequence AGCTGTGGGGTGCACTGAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938081725_938081731 11 Left 938081725 2:128373780-128373802 CCTGTCTTCTCACACCTTCTGCT No data
Right 938081731 2:128373814-128373836 AGCTGTGGGGTGCACTGAACTGG No data
938081726_938081731 -3 Left 938081726 2:128373794-128373816 CCTTCTGCTGCAGCCAAGCAAGC No data
Right 938081731 2:128373814-128373836 AGCTGTGGGGTGCACTGAACTGG No data
938081724_938081731 12 Left 938081724 2:128373779-128373801 CCCTGTCTTCTCACACCTTCTGC No data
Right 938081731 2:128373814-128373836 AGCTGTGGGGTGCACTGAACTGG No data
938081722_938081731 24 Left 938081722 2:128373767-128373789 CCTTTCCATTCTCCCTGTCTTCT No data
Right 938081731 2:128373814-128373836 AGCTGTGGGGTGCACTGAACTGG No data
938081723_938081731 19 Left 938081723 2:128373772-128373794 CCATTCTCCCTGTCTTCTCACAC No data
Right 938081731 2:128373814-128373836 AGCTGTGGGGTGCACTGAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938081731 Original CRISPR AGCTGTGGGGTGCACTGAAC TGG Intergenic
No off target data available for this crispr