ID: 938081732

View in Genome Browser
Species Human (GRCh38)
Location 2:128373815-128373837
Sequence GCTGTGGGGTGCACTGAACT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938081726_938081732 -2 Left 938081726 2:128373794-128373816 CCTTCTGCTGCAGCCAAGCAAGC No data
Right 938081732 2:128373815-128373837 GCTGTGGGGTGCACTGAACTGGG No data
938081725_938081732 12 Left 938081725 2:128373780-128373802 CCTGTCTTCTCACACCTTCTGCT No data
Right 938081732 2:128373815-128373837 GCTGTGGGGTGCACTGAACTGGG No data
938081722_938081732 25 Left 938081722 2:128373767-128373789 CCTTTCCATTCTCCCTGTCTTCT No data
Right 938081732 2:128373815-128373837 GCTGTGGGGTGCACTGAACTGGG No data
938081723_938081732 20 Left 938081723 2:128373772-128373794 CCATTCTCCCTGTCTTCTCACAC No data
Right 938081732 2:128373815-128373837 GCTGTGGGGTGCACTGAACTGGG No data
938081724_938081732 13 Left 938081724 2:128373779-128373801 CCCTGTCTTCTCACACCTTCTGC No data
Right 938081732 2:128373815-128373837 GCTGTGGGGTGCACTGAACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938081732 Original CRISPR GCTGTGGGGTGCACTGAACT GGG Intergenic