ID: 938081733

View in Genome Browser
Species Human (GRCh38)
Location 2:128373816-128373838
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938081726_938081733 -1 Left 938081726 2:128373794-128373816 CCTTCTGCTGCAGCCAAGCAAGC No data
Right 938081733 2:128373816-128373838 CTGTGGGGTGCACTGAACTGGGG No data
938081724_938081733 14 Left 938081724 2:128373779-128373801 CCCTGTCTTCTCACACCTTCTGC No data
Right 938081733 2:128373816-128373838 CTGTGGGGTGCACTGAACTGGGG No data
938081722_938081733 26 Left 938081722 2:128373767-128373789 CCTTTCCATTCTCCCTGTCTTCT No data
Right 938081733 2:128373816-128373838 CTGTGGGGTGCACTGAACTGGGG No data
938081725_938081733 13 Left 938081725 2:128373780-128373802 CCTGTCTTCTCACACCTTCTGCT No data
Right 938081733 2:128373816-128373838 CTGTGGGGTGCACTGAACTGGGG No data
938081723_938081733 21 Left 938081723 2:128373772-128373794 CCATTCTCCCTGTCTTCTCACAC No data
Right 938081733 2:128373816-128373838 CTGTGGGGTGCACTGAACTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type