ID: 938081891

View in Genome Browser
Species Human (GRCh38)
Location 2:128374590-128374612
Sequence GTACCCACTCGGCACCCCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938081885_938081891 11 Left 938081885 2:128374556-128374578 CCCAGCTAGGCACAGGGCTGGGC No data
Right 938081891 2:128374590-128374612 GTACCCACTCGGCACCCCTGTGG No data
938081886_938081891 10 Left 938081886 2:128374557-128374579 CCAGCTAGGCACAGGGCTGGGCA No data
Right 938081891 2:128374590-128374612 GTACCCACTCGGCACCCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938081891 Original CRISPR GTACCCACTCGGCACCCCTG TGG Intergenic
No off target data available for this crispr