ID: 938083242

View in Genome Browser
Species Human (GRCh38)
Location 2:128381298-128381320
Sequence CTGGAGACCAGGCCTGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938083232_938083242 12 Left 938083232 2:128381263-128381285 CCCTGCACATGTGACCTGCATAT No data
Right 938083242 2:128381298-128381320 CTGGAGACCAGGCCTGAGGAGGG No data
938083233_938083242 11 Left 938083233 2:128381264-128381286 CCTGCACATGTGACCTGCATATC No data
Right 938083242 2:128381298-128381320 CTGGAGACCAGGCCTGAGGAGGG No data
938083231_938083242 25 Left 938083231 2:128381250-128381272 CCTGTCAGAGTGTCCCTGCACAT No data
Right 938083242 2:128381298-128381320 CTGGAGACCAGGCCTGAGGAGGG No data
938083234_938083242 -2 Left 938083234 2:128381277-128381299 CCTGCATATCCTCCCTAGTGTCT No data
Right 938083242 2:128381298-128381320 CTGGAGACCAGGCCTGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938083242 Original CRISPR CTGGAGACCAGGCCTGAGGA GGG Intergenic
No off target data available for this crispr