ID: 938083834

View in Genome Browser
Species Human (GRCh38)
Location 2:128385267-128385289
Sequence CGGCCCGCCGTGGTTTCCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938083834_938083840 -4 Left 938083834 2:128385267-128385289 CCTCTGGAAACCACGGCGGGCCG No data
Right 938083840 2:128385286-128385308 GCCGCCAATGGAGGGCAGATGGG No data
938083834_938083839 -5 Left 938083834 2:128385267-128385289 CCTCTGGAAACCACGGCGGGCCG No data
Right 938083839 2:128385285-128385307 GGCCGCCAATGGAGGGCAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938083834 Original CRISPR CGGCCCGCCGTGGTTTCCAG AGG (reversed) Intergenic
No off target data available for this crispr