ID: 938084066

View in Genome Browser
Species Human (GRCh38)
Location 2:128386682-128386704
Sequence GATACTAGTGAGATTGGATC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938084061_938084066 24 Left 938084061 2:128386635-128386657 CCTCTGTGTGTGCATCTGGTTCG No data
Right 938084066 2:128386682-128386704 GATACTAGTGAGATTGGATCAGG No data
938084060_938084066 25 Left 938084060 2:128386634-128386656 CCCTCTGTGTGTGCATCTGGTTC No data
Right 938084066 2:128386682-128386704 GATACTAGTGAGATTGGATCAGG No data
938084064_938084066 -6 Left 938084064 2:128386665-128386687 CCTGTCTGTTGTCTAAGGATACT No data
Right 938084066 2:128386682-128386704 GATACTAGTGAGATTGGATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938084066 Original CRISPR GATACTAGTGAGATTGGATC AGG Intergenic
No off target data available for this crispr