ID: 938084487

View in Genome Browser
Species Human (GRCh38)
Location 2:128389788-128389810
Sequence GCCCCCAACAGAGTCCCCTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938084487_938084492 9 Left 938084487 2:128389788-128389810 CCCTAGGGGACTCTGTTGGGGGC No data
Right 938084492 2:128389820-128389842 ATGAGCAGAAGCCAAACTAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938084487 Original CRISPR GCCCCCAACAGAGTCCCCTA GGG (reversed) Intergenic