ID: 938084488

View in Genome Browser
Species Human (GRCh38)
Location 2:128389789-128389811
Sequence GGCCCCCAACAGAGTCCCCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938084488_938084492 8 Left 938084488 2:128389789-128389811 CCTAGGGGACTCTGTTGGGGGCC No data
Right 938084492 2:128389820-128389842 ATGAGCAGAAGCCAAACTAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938084488 Original CRISPR GGCCCCCAACAGAGTCCCCT AGG (reversed) Intergenic
No off target data available for this crispr