ID: 938084492

View in Genome Browser
Species Human (GRCh38)
Location 2:128389820-128389842
Sequence ATGAGCAGAAGCCAAACTAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938084487_938084492 9 Left 938084487 2:128389788-128389810 CCCTAGGGGACTCTGTTGGGGGC No data
Right 938084492 2:128389820-128389842 ATGAGCAGAAGCCAAACTAGTGG No data
938084488_938084492 8 Left 938084488 2:128389789-128389811 CCTAGGGGACTCTGTTGGGGGCC No data
Right 938084492 2:128389820-128389842 ATGAGCAGAAGCCAAACTAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938084492 Original CRISPR ATGAGCAGAAGCCAAACTAG TGG Intergenic
No off target data available for this crispr