ID: 938090731

View in Genome Browser
Species Human (GRCh38)
Location 2:128432939-128432961
Sequence CTGTCCCCCAAGCTGGAGTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 12765
Summary {0: 3, 1: 26, 2: 638, 3: 5195, 4: 6903}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938090728_938090731 19 Left 938090728 2:128432897-128432919 CCATTTGGTTCTTTTTTTTTTTT 0: 6
1: 98
2: 1466
3: 31460
4: 54749
Right 938090731 2:128432939-128432961 CTGTCCCCCAAGCTGGAGTATGG 0: 3
1: 26
2: 638
3: 5195
4: 6903

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938090731 Original CRISPR CTGTCCCCCAAGCTGGAGTA TGG Intergenic
Too many off-targets to display for this crispr