ID: 938090941

View in Genome Browser
Species Human (GRCh38)
Location 2:128434346-128434368
Sequence TTGTTGCTGGTTAGGGAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938090932_938090941 -4 Left 938090932 2:128434327-128434349 CCCTCACAGGCCTGCCCAGTTGT No data
Right 938090941 2:128434346-128434368 TTGTTGCTGGTTAGGGAAGGAGG No data
938090924_938090941 27 Left 938090924 2:128434296-128434318 CCCTAGACTGGGCCACCTGCTGC No data
Right 938090941 2:128434346-128434368 TTGTTGCTGGTTAGGGAAGGAGG No data
938090931_938090941 -3 Left 938090931 2:128434326-128434348 CCCCTCACAGGCCTGCCCAGTTG No data
Right 938090941 2:128434346-128434368 TTGTTGCTGGTTAGGGAAGGAGG No data
938090925_938090941 26 Left 938090925 2:128434297-128434319 CCTAGACTGGGCCACCTGCTGCA No data
Right 938090941 2:128434346-128434368 TTGTTGCTGGTTAGGGAAGGAGG No data
938090929_938090941 12 Left 938090929 2:128434311-128434333 CCTGCTGCAGCTGGGCCCCTCAC No data
Right 938090941 2:128434346-128434368 TTGTTGCTGGTTAGGGAAGGAGG No data
938090923_938090941 28 Left 938090923 2:128434295-128434317 CCCCTAGACTGGGCCACCTGCTG No data
Right 938090941 2:128434346-128434368 TTGTTGCTGGTTAGGGAAGGAGG No data
938090933_938090941 -5 Left 938090933 2:128434328-128434350 CCTCACAGGCCTGCCCAGTTGTT No data
Right 938090941 2:128434346-128434368 TTGTTGCTGGTTAGGGAAGGAGG No data
938090928_938090941 15 Left 938090928 2:128434308-128434330 CCACCTGCTGCAGCTGGGCCCCT No data
Right 938090941 2:128434346-128434368 TTGTTGCTGGTTAGGGAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938090941 Original CRISPR TTGTTGCTGGTTAGGGAAGG AGG Intergenic
No off target data available for this crispr