ID: 938091061

View in Genome Browser
Species Human (GRCh38)
Location 2:128435097-128435119
Sequence AGGAAGCAGCAGAAGCAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938091058_938091061 3 Left 938091058 2:128435071-128435093 CCTGAAGTGTGAAATCTTGGCAT No data
Right 938091061 2:128435097-128435119 AGGAAGCAGCAGAAGCAGGAAGG No data
938091057_938091061 4 Left 938091057 2:128435070-128435092 CCCTGAAGTGTGAAATCTTGGCA No data
Right 938091061 2:128435097-128435119 AGGAAGCAGCAGAAGCAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938091061 Original CRISPR AGGAAGCAGCAGAAGCAGGA AGG Intergenic
No off target data available for this crispr