ID: 938091872

View in Genome Browser
Species Human (GRCh38)
Location 2:128439798-128439820
Sequence CTCAGAGGGCACCTTGATTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938091864_938091872 4 Left 938091864 2:128439771-128439793 CCGGGGACAGAGCCTTCCCTCAC No data
Right 938091872 2:128439798-128439820 CTCAGAGGGCACCTTGATTTTGG No data
938091865_938091872 -8 Left 938091865 2:128439783-128439805 CCTTCCCTCACAGCCCTCAGAGG 0: 6
1: 41
2: 108
3: 192
4: 567
Right 938091872 2:128439798-128439820 CTCAGAGGGCACCTTGATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938091872 Original CRISPR CTCAGAGGGCACCTTGATTT TGG Intergenic
No off target data available for this crispr