ID: 938092148

View in Genome Browser
Species Human (GRCh38)
Location 2:128441018-128441040
Sequence CAGCATCTGATGGGCTCCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938092148_938092154 6 Left 938092148 2:128441018-128441040 CCAGGGGAGCCCATCAGATGCTG No data
Right 938092154 2:128441047-128441069 GGGTCCCACCAGTTCTCATCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938092148 Original CRISPR CAGCATCTGATGGGCTCCCC TGG (reversed) Intergenic
No off target data available for this crispr