ID: 938093519

View in Genome Browser
Species Human (GRCh38)
Location 2:128447901-128447923
Sequence GACCCACTGCGTTACAGTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938093507_938093519 12 Left 938093507 2:128447866-128447888 CCACAGCATTATGGTTGGGGTAG No data
Right 938093519 2:128447901-128447923 GACCCACTGCGTTACAGTGGGGG No data
938093506_938093519 13 Left 938093506 2:128447865-128447887 CCCACAGCATTATGGTTGGGGTA No data
Right 938093519 2:128447901-128447923 GACCCACTGCGTTACAGTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938093519 Original CRISPR GACCCACTGCGTTACAGTGG GGG Intergenic
No off target data available for this crispr