ID: 938093559

View in Genome Browser
Species Human (GRCh38)
Location 2:128448013-128448035
Sequence GACCCACAGCGTTACAGTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938093548_938093559 12 Left 938093548 2:128447978-128448000 CCCACAGAGCTATGGTGGGGGCA No data
Right 938093559 2:128448013-128448035 GACCCACAGCGTTACAGTGGGGG No data
938093549_938093559 11 Left 938093549 2:128447979-128448001 CCACAGAGCTATGGTGGGGGCAG No data
Right 938093559 2:128448013-128448035 GACCCACAGCGTTACAGTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938093559 Original CRISPR GACCCACAGCGTTACAGTGG GGG Intergenic
No off target data available for this crispr