ID: 938093847

View in Genome Browser
Species Human (GRCh38)
Location 2:128449237-128449259
Sequence GTAAAACCCCTGAGGGGTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938093836_938093847 18 Left 938093836 2:128449196-128449218 CCCCCTGGTCATTACAGGTACAC No data
Right 938093847 2:128449237-128449259 GTAAAACCCCTGAGGGGTCAGGG No data
938093837_938093847 17 Left 938093837 2:128449197-128449219 CCCCTGGTCATTACAGGTACACG No data
Right 938093847 2:128449237-128449259 GTAAAACCCCTGAGGGGTCAGGG No data
938093838_938093847 16 Left 938093838 2:128449198-128449220 CCCTGGTCATTACAGGTACACGC No data
Right 938093847 2:128449237-128449259 GTAAAACCCCTGAGGGGTCAGGG No data
938093839_938093847 15 Left 938093839 2:128449199-128449221 CCTGGTCATTACAGGTACACGCA No data
Right 938093847 2:128449237-128449259 GTAAAACCCCTGAGGGGTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938093847 Original CRISPR GTAAAACCCCTGAGGGGTCA GGG Intergenic
No off target data available for this crispr