ID: 938095288

View in Genome Browser
Species Human (GRCh38)
Location 2:128457424-128457446
Sequence GGCTCAGTCATCACTTGGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938095288_938095295 -1 Left 938095288 2:128457424-128457446 CCAACCCAAGTGATGACTGAGCC No data
Right 938095295 2:128457446-128457468 CTGTGCTGACCAGGAGCTAGGGG No data
938095288_938095294 -2 Left 938095288 2:128457424-128457446 CCAACCCAAGTGATGACTGAGCC No data
Right 938095294 2:128457445-128457467 CCTGTGCTGACCAGGAGCTAGGG No data
938095288_938095292 -3 Left 938095288 2:128457424-128457446 CCAACCCAAGTGATGACTGAGCC No data
Right 938095292 2:128457444-128457466 GCCTGTGCTGACCAGGAGCTAGG No data
938095288_938095291 -10 Left 938095288 2:128457424-128457446 CCAACCCAAGTGATGACTGAGCC No data
Right 938095291 2:128457437-128457459 TGACTGAGCCTGTGCTGACCAGG No data
938095288_938095297 7 Left 938095288 2:128457424-128457446 CCAACCCAAGTGATGACTGAGCC No data
Right 938095297 2:128457454-128457476 ACCAGGAGCTAGGGGGCAGCAGG No data
938095288_938095296 0 Left 938095288 2:128457424-128457446 CCAACCCAAGTGATGACTGAGCC No data
Right 938095296 2:128457447-128457469 TGTGCTGACCAGGAGCTAGGGGG No data
938095288_938095300 22 Left 938095288 2:128457424-128457446 CCAACCCAAGTGATGACTGAGCC No data
Right 938095300 2:128457469-128457491 GCAGCAGGTCCTTTAGCTGAGGG No data
938095288_938095299 21 Left 938095288 2:128457424-128457446 CCAACCCAAGTGATGACTGAGCC No data
Right 938095299 2:128457468-128457490 GGCAGCAGGTCCTTTAGCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938095288 Original CRISPR GGCTCAGTCATCACTTGGGT TGG (reversed) Intergenic
No off target data available for this crispr