ID: 938097663

View in Genome Browser
Species Human (GRCh38)
Location 2:128474115-128474137
Sequence GGCTCAAACCCCTGAGGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938097663_938097670 25 Left 938097663 2:128474115-128474137 CCTGCTCCTCAGGGGTTTGAGCC No data
Right 938097670 2:128474163-128474185 CTCACAGAGCTCTCATGTCCAGG No data
938097663_938097671 26 Left 938097663 2:128474115-128474137 CCTGCTCCTCAGGGGTTTGAGCC No data
Right 938097671 2:128474164-128474186 TCACAGAGCTCTCATGTCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938097663 Original CRISPR GGCTCAAACCCCTGAGGAGC AGG (reversed) Intergenic
No off target data available for this crispr