ID: 938099708

View in Genome Browser
Species Human (GRCh38)
Location 2:128490439-128490461
Sequence CAGGCAAAGGAGAAGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938099702_938099708 13 Left 938099702 2:128490403-128490425 CCTGTTGGTGGTCTCTTCACACG 0: 16
1: 45
2: 36
3: 18
4: 59
Right 938099708 2:128490439-128490461 CAGGCAAAGGAGAAGGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938099708 Original CRISPR CAGGCAAAGGAGAAGGAGGA AGG Intergenic
No off target data available for this crispr