ID: 938100402

View in Genome Browser
Species Human (GRCh38)
Location 2:128494073-128494095
Sequence CTGCGGTGTCAGAAGATTAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938100402_938100405 -4 Left 938100402 2:128494073-128494095 CCCTTAATCTTCTGACACCGCAG No data
Right 938100405 2:128494092-128494114 GCAGTTCCTCGTCTGTGAAGTGG No data
938100402_938100408 21 Left 938100402 2:128494073-128494095 CCCTTAATCTTCTGACACCGCAG No data
Right 938100408 2:128494117-128494139 GTAATATCACCTGCCTCTAGAGG No data
938100402_938100406 -3 Left 938100402 2:128494073-128494095 CCCTTAATCTTCTGACACCGCAG No data
Right 938100406 2:128494093-128494115 CAGTTCCTCGTCTGTGAAGTGGG No data
938100402_938100410 30 Left 938100402 2:128494073-128494095 CCCTTAATCTTCTGACACCGCAG No data
Right 938100410 2:128494126-128494148 CCTGCCTCTAGAGGCATGCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938100402 Original CRISPR CTGCGGTGTCAGAAGATTAA GGG (reversed) Intergenic
No off target data available for this crispr